
USA:ssa tunnetusti kenestä tahansa voi tulla presidentti. Kenestä tahansa voi periaatteessa tulla myös huippututkija ja miljardiyrittäjä. Ei tarvitse vält-tämättä olla ihmelapsi, ei käydä kalleimpia "parhaita" kouluja" eikä istua ra-hasäiliön päällä. Aina ei tarvitse räävittömästä huijata tai fuskatakaan. Pitää olla sattumalta oikeassa saumassa, missä tapahtuu,ja käyttää järjestelmän tarjoamia mahdollisuuksia pelimielessä maksimaalisesti omaksi hyödykseen.
John Craig Venter syntyi 14. 10. 1946 Salt Lake Cityssä Utahissa USAn mormonialueella, ja kuoli 29. 4. 2026 San Diegossa syöpähoidon sivuvaikutuksiin. Voisi olettaa, että hän kokeili itsellään jotakin uutta geenisyöpähoitoa. Perhe muutti Millbraen kaupunkiin Kalifornian rannikolle pojan ollessa kuoluainen. Vanhemmat toimivat ilmeisesti Golf-alalla. Poika menestyi koulussa huonosti. Häntä kiinnostivat eniten veneily ja surffaus. High Schoolkin jäi kesken. Venter vastusti aktiivisesti Vietnamin sotaa, mutta ymmärsi, että hänen kaltaisensa joutilaan oloinen terve nuorimies joutuu sinne kuitenkin joka tapauksessa varmasti, ja värväytyi vapaaehtoisesti USAn laivastoon voidakseen ainakin aluksi vaikuttaa siihen, mihin tehtäviin joutuu. Hän palveli lääkintäkorpraalina (hospital corpsman) laivaston huoltojoukoissa (Naval Support Activity) tehohoitoyksikössä Danangissa 1967–68 joutuen mm kuuluisan TET-hyökkäyksen "rulliin".
Sotahommat eivät edelleenkään Venteriä kiehtoneet, ja hän harkitsi ja valmisteli jopa itsemurhaakin. Sen sijaan hän kyllä kiinnostui laitteista ja hoidoista, joita siellä kovasti kehiteltiin ja testattiin. Onnistuttuaan vapautumaan armeijasta hoidettuaan tuhansia haavoittuneita sotiaita hän kirjautui vuonna 1969 aikuis-collegeen lopettelemaan perusopintojaan, josta pääsi San Diegon ylipistoon opiskelemaan biokemiaa, josta suoritti kandidaatin (bachelor) tutkinnon jo vuonna 1972 ja Nathan O. Kaplanin johdolla filosofian tohtorin tutkinnon 1975 aloinaan fysiologia ja farmakologia. Hän mm. sekvensoi itsellään geenin, jota arveltiin modernin ADHDn aiheuttajaksi Työskenneltyään apulaisprofessorina ja myöhemmin professorina New Yorkin osavaltionyliopistossa Buffalossa hän liittyi Yhdysvaltain Liittovaltion terveysinstituuttiin (NIH) vuonna 1984.
NIH:n työntekijänä Venter oppi tunnistamaan mRNA:ta ja alkoi tutkia lisää sitä, miten "sitä ilmentyy" ihmisaivoissa. Venter nimesi automaattisella DNA-sekvensoinnilla löytämänsä lyhyet cDNA-sekvenssifragmentit ilmentymissekvenssitunnisteiksi eli EST:eiksi. NIH:n teknologiansiirtotoimisto päätti hakea patenttia Venterin löytämille EST:ille ja patentoida geenit, jotka tunnistettiin mRNA:n ilmentymistä ihmisaivoissa koskevien tutkimusten perusteella. Kun Venter paljasti NIH:n strategian kongressin kuulemistilaisuudessa, puhkesi vastaausemyrsky. [24] NIH lopetti myöhemmin hankkeen ja hylkäsi jättämänsä patenttihakemukset julkisen vastalauseen jälkeen.
Craig Venter näyttäisi tutkimusotteestaan ja sanavainnoistaan pääteen nojanneen RNAn öytäjien Jacques Monod´n ja Farancois Jacobin ajatteuun ja filosofioihin. Hän oli vakaumukseinen ateisti, joka suhtautui kuitenkin uskontoihin myönteisesti, koska oli taipuvainen ajattelemaan, että ihmisellä olisi synnynnlläinen uskonnollisuuden tarve.
Susi idea ihmisen geenien "patentoimisesta" oli NIH:n itsensä ja siten valtiollisen geenikartoitusprojektin eikä Venterin. Venter uskoi, että koko genomin ns. haulikkosekvensointi olisi nopein ja tehokkain tapa saada hyödyllistä ihmisen genomitietoa. Ihmisen genomiprojekti kuitenkin hylkäsi menetelmän, koska jotkut geneetikot katsoivat sen olevan liian epätarkka niin monimutkaiselle genomille kuin ihmisen genomi. Hän näki Ihmisen genomiprojektin hitaan edistymisvauhdin tilaisuutena jatkaa kiinnostustaan kokeilla haulikkosekvensointimenetelmäänsä ihmisen genomin sekvensoinnin nopeuttamiseksi, joten hän haki rahoitusta yksityiseltä sektorilta Celera Genomicsin perustamiseksi. Homman taustalla lienee USAlaiset johto-opit siitä, että tarpeeksi tärkeälle toiminnalle pitää aina joskakin vaikka keksaista kilpailija, jotta se etenisi hyvin; saman konsernin eri osastot saattavat kipailla verissä päin, samoin USAn lukuisat puolisotilaalliset turvallisuusorganisaatit kuten CIA, FBI, ICE, FEMA ja Kansalliskaartit.
Toisin kuin esimerkiksi minäkin olen joissakin vanhoissa kirjoituksissani virheellisesti väittänyt, ihmisen genomin kartoitusprojektin yksityisen haaran johtaja Craig Venter ei johtanut Obaman sutta Neuronal Connectome -projektia missään vaiheessa, vaikka sen olikin tarkoitus perustua "geenipäästään" nimenomaan hänen kartoituksilleen. Googlen hakukonetekoälyn mukaan hän ei ollut siinä organisatorisesti mukana oenkaan, vaan Celera Genomics teki sille hankkeelle ilmeisesti kaupallista palvelututkimusta.
https://unu.edu/biolac/news/memoriam-dr-j-craig-venter
" In Memoriam: Dr. J. Craig Venter
Periksiantamatn pyrkimys ymmärtää geneettisen koodin ja biologisen toiminnan välistä suhdetta
5. toukokuuta 2026
Valokuva Craig Venteristä, kemististä, Synthetic Genomicsista, T. T. Chaon innovaa-tiosymposiumissa, jonka Rice's BioScience Research Collaborative järjesti 28. lokakuuta 2011. Järjestäjä: Chemical Heritage Foundation, Philadelphia, PA, USA.
Mauricio Ramirez, Science History Institute
Tohtori John Craig Venterin, yhden 2000-luvun vaikutusvaltaisimmista biologeista, poismenossa on tiettyä ironiaa. Hän kuoli San Diegossa 29. huhtikuuta 2026 79-vuotiaana syöpähoitojen aiheuttamiin komplikaatioihin. Suuri osa hänen tieteellisestä ja yrittäjäurastaan oli omistettu juuri ihmisen pitkäikäisyyden geneettisten ja molekyylitason rajoitusten kohtaamiseen.
Silti hänen elämäntyönsä tekee selväksi, että jos joku oli asemassa yrittämään näin kunnianhimoista tavoitetta, se oli Craig Venter. Salt Lake Cityssä, Utahissa, 14. loka-kuuta 1946 syntynyt Venter mullistaa modernin biologian korostamalla genomiikan nopeutta, skaalautuvuutta ja toiminnallista tulkintaa. Hänen panoksensa eivät aino-astaan muuttaneet bioteknologiaa ja biolääketieteellistä tutkimusta, vaan ne myös auttoivat määrittelemään merkittävän osan tieteellisestä maisemasta, jossa UNU-BIOLAC on toiminut viimeisten kahden vuosikymmenen aikana.
Geeneistä genomeihin: biologisen tutkimuksen uudelleenmäärittely
Venter nousi ensimmäisen kerran tunnetuksi 1980-luvun lopulla ja 1990-luvun alus-sa kehittämällä Yhdysvaltain kansallisissa terveyslaitoksissa (NIH) ekspressoituja sekvenssitunnisteita (EST). Tämä menetelmä mahdollisti proteiineja koodaavien geenien nopean tunnistamisen suoraan transkriptoidusta RNA:sta. Tämä lähesty-mistapa perustui vakaumukseen, että mitään sairautta ei voida täysin ymmärtää paljastamatta sen geneettistä perustaa.
Tämä vakaumus johti häntä vielä pidemmälle. Hylättyään hitaat, karttapohjaiset sek-vensointistrategiat Venter kannatti koko genomin haulikkosekvensointia, menetel-mää, jossa suuret genomit fragmentoidaan pieniksi paloiksi, sekvensoidaan nopeasti ja sitten kootaan laskennallisesti. Tämän lähestymistavan teho osoitettiin ratkaise-vasti vuonna 1995,kun hänen tiiminsä Genomic Research Institutessa (TIGR) julkai-si ensimmäisen vapaasti elävän organismin, Haemophilus influenzaen, täydellisen genomisekvenssin,joka käsitti noin1,83 miljoonaa emäsparia.Tuolloin oli sekvensoitu vain kolme kertaluokkaa pienempiä virusgenomeja, mikä teki tästä käännekohdan biologialle datalähtöisenä tieteenä.
Ihmisen genomi ja suurtehobiologian nousu
Venterin menetelmät mahdollistivat hänen yrityksensä, Celera Genomicsin, osallistu-misen – myöhään mutta ratkaisevasti – kansainväliseen kilpailuun ihmisen genomin sekvensoimiseksi. Vuonna 2001 Celera ja julkisesti rahoitettu Human Genome Pro-ject ilmoittivat yhdessä ensimmäisestä luonnoksesta ihmisen genomisekvenssistä. Tämä virstanpylväs toi biologian digitaaliseen aikakauteen ja samalla ruokki intensiivistä julkista keskustelua tiedon omistajuudesta, kilpailusta ja yhteistyöstä tieteellisessä työssä.
Samaan aikaan Celera tuotti myös Drosophila melanogasterin täydellisen genomi-sekvenssin ja julkaisi myöhemmin ensimmäisen korkealaatuisen diploidisen ihmisen genomin, paljastaen yksilöllisen geneettisen vaihtelun merkityksen. Se, että Venter itse oli DNA:n luovuttaja, lisäsi sekä ihailua että kiistoja, mikä vahvisti hänen mainettaan rohkeana ja mielipiteitä jakavana tieteellisenä hahmona.
Metagenomiikka ja elämä laboratorion ulkopuolella
Venter ei rajoittunut pelkästään ihmisbiologiaan, vaan sijoitti suuren osan tieteellises-tä ja kaupallisesta menestyksestään laajamittaiseen tutkimukseen.Sorcerer II Global Ocean Sampling Expeditionin (2003-2007) aikana hänen kelluva genomilaborato-rionsa kiersi maapallon ja löysi miljoonia aiemmin tuntemattomia mikrobigeenejä meriympäristöistä.
Tämä työ oli ensimmäinen onnistunut metagenomiikan konseptitodistus, joka mah-dollisti biologisen monimuotoisuuden ja toiminnan tutkimisen organismeissa, joita ei voida viljellä laboratoriossa. Tämä menetelmä on nyt perustana maailmanlaajuiselle mikrobiomeja, ekosysteemejä ja planeetan terveyttä koskevalle tutkimukselle.
Synteettinen biologia: elämän lukemisesta sen kirjoittamiseen
Venterin elinikäinen pyrkimys yhdistää geneettinen koodi biologiseen toimintaan hui-pentui toukokuussa 2010,kun hänen tiiminsä J.Craig Venter -instituutissa ilmoitti luo-neensa ensimmäisen kemiallisesti syntetisoidun genomin ohjaaman itsereplikoituvan bakteerisolun, Mycoplasma mycoides JCVI-syn1.0:n.Noin 1,08 miljoonaa emäsparia käsittävä synteettinen kromosomi suunniteltiin digitaalisesti, koottiin kemiallisista komponenteista ja "käynnistettiin" onnistuneesti vastaanottajasolussa.
Tämä saavutus merkitsi synteettisen biologian syntyä käytännön tieteenalana ja osoitti, että genomeja voidaan paitsi lukea myös kirjoittaa, muokata ja toiminnallisesti validoida.
Pysyvä perintö bioteknologialle ja UNU-BIOLACille
Funktionaalinen genomin annotointi, haulikkosekvensointi, seuraavan sukupolven sekvensointitekniikat, metagenomiikka, mikrobiomitiede, ja synteettinen biologia voisivat helposti kuvata UNU-BIOLACin akateemista ja koulutusohjelmaa vuosille 2025–2026. Kaikkien näiden alojen käsitteellinen alkuperä on merkittävä – ellei jopa yksinomainen – tohtori J. Craig Venterin provosoivassa ja mullistavassa visiossa, joka korosti johdonmukaisesti biotekniikan kykyä tarjota todellisia ratkaisuja ihmisten hyvinvoinnille.
Venter oli edelläkävijä ja armoton perinteiden haastaja.Koska hän uskoi, että elämän ymmärtäminen vaatii sekä rohkeita ideoita että rohkeutta rakentaa työkaluja niiden testaamiseksi, haluamme todistaa, kuinka hänen tunnetusti konfrontaatiohakuinen akateeminen persoonallisuutensa nopeutti löytöjä ja kehitystä jatkuvasti vaatimalla, että enemmän voitaisiin saavuttaa. "
xxx
AI-yhteenveto
There is no recognized scientific program officially titled the "Craig Venter Neural Gene Connectome Program." Dr. Craig Venter is world-renowned for his pioneering work in genomics—including leading the privately funded effort to sequence the human genome and building the first synthetic cell.
National Institutes of Health (.gov)
1
However, the intersection of his genomics work and brain connectivity concepts generally falls into three separate, established research tracks:
1. The Human Connectome Project (HCP)
Venter is not the primary director of this initiative, but his genomic breakthroughs paved the way for it. The Human Connectome Project is a massive NIH-funded initiative launched in 2009 to map the structural and functional neural pathways of the healthy human brain. It aims to connect these brain mappings with behavioral and genetic data.
Tomorrow Bio
2. Genetics of the Connectome
Connectomics and genomics frequently intersect in modern neuroscience to deter-mine how genetic variations influence the physical and functional wiring of the brain. Research in this area reveals that anatomical connectivity is under stronger genetic influence than functional connectivity.
National Institutes of Health (.gov)
3. Venter's Syn 3.0 (Minimal Genome)
At the J. Craig Venter Institute (JCVI), Venter’s team successfully synthesized Syn 3.0, a stripped-down synthetic genome containing the fewest genes of any freely living organism (473 genes). This cell acts as a universal foundational tool for researchers seeking to understand the minimal genetic requirements for life.
Wikipedia
If you are looking for specific genomic-neurological programs, you might be thinking of the NIH BRAIN Initiative, which maps out how individual cells and genes interact to form functioning neural circuits in the human brain.
xxx
AI-yhteenveto
Craig Venter is an atheist. He does not believe in a God or a higher power, viewing life strictly through the lens of material chemistry and DNA rather than mystical or supernatural forces.
His views on the subject are well documented:
The "Religiosity Gene": Venter has famously joked that if there were a gene for religiosity, his was deleted.
Early Exposure: He was briefly exposed to religious instruction as a child but quickly abandoned it, as the literal creation stories conflicted with his scientific curiosity and understanding of evolutionary science.
Science and Ethics: While he does not practice a religion, he has acknowledged the cultural and ethical importance of religious perspectives (such as those of the Vatican) in public policy debates regarding genomics and synthetic biology.
For more context on how his materialist worldview shapes his work in genomics, you can read more in The Guardian's overview of his synthetic biology or check out the PLOS DNA Science Blog detailing his childhood experiences.
https://www.theguardian.com/theguardian/2000/may/06/weekend7.weekend1
" DNA: It's war (part one)
Sat 6 May 2000 03.01 CEST
Decoding the human genome will change the world. But, says Kevin Toolis, it's not just about science; it's UK vs US; public spirit vs private enterprise. And it's personal
It should have been the grandest of scientific occasions. On stage at the world-renowned Pasteur Institute in Paris, Craig Venter, one of the world's foremost biological scientists, announced he was just weeks away from completing the greatest scientific endeavour that mankind has ever known: the human genome, the book of life of Homo sapiens . It should have been a victory lap, applause, praise, talk of Nobel prizes, and commendations from his peers.
But instead there was silence. For most of the 600 academics in the audience, gathered from research institutes across the globe, Venter was the traitor; a ruthless competitor who sold his soul to American business and who now plans to charge the rest of the human race a fortune to read our own genetic code. "I was totally against him being invited to speak," said one of the conference organisers bitterly. "His first announcement when he created his company, Celera, was to attack the publicly-funded Human Genome Project. He wanted the public project to be closed so he would have a monopoly. He is extremely aggressive in his statements because, of course, he is speaking not to scientists but to his shareholders."
To his critics, the American scientist is "Darth Venter", an evil monopolist. To his admirers, he's a genius - "the Alan Turing [conqueror of the Enigma code] of his generation" - who more than anyone has revolutionised the field of genomics but, through the jealousy of scientific pygmies, has been unjustly denied credit. "You cannot repeal the laws of human nature," says Dr Sam Broder, a former director of the US National Cancer Institute and now chief medical officer at Celera. "It would be appropriate if someone said, 'I'm angry, I'm jealous, I can't stand this.' It would be better if people had the courage to come out with it."
Beneath the venom towards Venter lies another human emotion - fear. "Everyone is frightened of losing," said a senior scientist from the Pasteur Institute. "The human genome is only going to be sequenced once and it will never need to be done again. There are Nobel prizes riding on this. It's a big, big prize and it's technology driven. Craig is in cahoots with the American makers of the DNA sequencers we all use. He is also a self-aggrandising pain in the arse."
But the race for the code of the human genome is not just another arcane battle between boffins to see who wins the prize, even if it is a Nobel. It's a race for the future, a war being fought in science laboratories across the world, with battalions of $300,000 DNA sequencing machines that chunder out, in order, the four base letters of the human code - ccacatgatatctatccaacccatgtcc . . .
On one side is the publicly-funded Human Genome Project (HGP), which is decoding the human genome data and releasing it free of charge on the internet each night. And on the other is Celera, Venter's private upstart company founded in May 1998, which says its has decoded the genome cheaper and quicker than its slow-coach public rivals.
Celera does have a built-in advantage. Its scientists can access the two billion-plus letters already decoded by the Human Genome Project by simply looking it up on the HGP's websites. Celera's own data is strictly private, but Venter says he will also publish their human genome data on Celera's own website. His critics ask "when?" and "how much will it cost?" Inevitably, Celera will place some restrictions on the use of its data.
The race for the code is not just about science, it's also a tale of dirty tactics, brilliant scientific innovation, emotional insecurity, vicious bureaucratic in-fighting, black propaganda, rare joint presidential and prime ministerial statements, $225-a-share stock offerings, law suits and plain old-fashioned human goodness.
The Human Genome Project, largely funded by US tax dollars but with a third of the money from the British medical charity the Wellcome Trust, is vast, and there are many key scientists involved. But it has ultimately become a fierce personal battle between two men, the would-be American billionaire, high-school drop-out, ex-surfer and Vietnam War veteran, Craig Venter, and his runner-bean-growing, Oxfam-supporting, second-hand car driving, bearded British academic opponent, John Sulston, of the Wellcome Trust. And instead of academic papers, both men now trade insults such as "slimy" and "con job".
"The people from the Wellcome Trust do not believe this shit that they are saying," says Venter, leaning back on the chair in his office at his Rockville headquarters, near Washington. "It's much easier to demonise us than justify the hundreds of millions of dollars they have wasted. I have been a thorn in their side for some time because I keep coming up with breakthroughs. Having a rival in any sense is unacceptable to them. They are trying to destroy someone they view as a serious competitor. We did not set out to sequence the human genome just to make John Sulston and the Wellcome Trust look bad. What is it about Celera that has to be stopped - because we are trying to treat cancer, find treatments for disease?"
On the other side of the Atlantic, in his bare office in the shiny new Sanger Centre near Cambridge, Sulston takes an implacably hostile view of his enemy. "Global capitalism is raping the earth, it's raping us. If global capitalism gets hold of complete control of the human genome, that is very bad news indeed, that is something we should fight against. I believe that our basic information, our 'software', should be free and open for everyone to play with, to compete with, to try and make products from. I do not believe it should be under the control of one person. But that is what Celera are trying to do as far as they can. They want to establish a monopoly position on the human sequence. Craig has gone morally wrong."
The two men are roughly the same age - Venter is 54, Sulston, 57 - but could not be more different. Venter is brash, aggressive, egotistical. His list of considerable achievements trip off his tongue like a pre-printed CV. "Is my science of the level, with the breakthroughs, consistent with other people who have gotten the Nobel? Yes."
The walls of his office are covered in trophies, magazine covers of Venter, pictures of his naval graduating class and time in Vietnam, honorary degrees, and signed photos from Bill Clinton. During our interview, when he was not taking calls from Wall Street analysts, he was on the line to Business Week talking up Celera's stock price, or to his financial backers. He had a gold Rolex on his wrist, and sprawled at his feet were three huge black poodles, whom he calls "his children". When Venter is not darting around in the company Lear Jet, he is on his 84ft yacht, The Sorcerer, or flying to Saudi Arabia to pick up some prize, or attending the White House Correspondents dinner. He is now a player, lobbying his Congressional allies hard, up there in the big league in Washington. Fifteen years ago, microbiologists had to beg for grants. On February 29, 2000, Celera raised $1billion in one day on the New York Stock Exchange.
Venter likes to stand out from the dull pack of his fellow scientists. At one point he is called down to Celera's computer room, "whose Compaq computing power is rivalled only by the Pentagon", to pose for a New York photographer. He sits happily for 15 minutes, like a movie star. In more friendly times, Venter was once invited to a Wellcome Trust genomics conference in the Cotswolds. At Heathrow, the Trust laid on a bus to take arriving scientists directly to the conference. Venter was on the flight, but never took the bus - he turned up later in a hired Jaguar.
In contrast, the bearded Sulston is a model of quiet British understatement. Instead of a Rolex he was wearing a pair of old leather sandals. His wild beard and hair give him the air of being an ex-hippy professor. Sulston's father was a vicar and he has the same ideals of public service and social compassion. "The only thing I have retained from my upbringing - I did not retain the religious element - is the idea that you do not do things for money."
Sulston's office is lined not with power trophies but his old notebooks, filled with hand-drawn pictures of the dividing cells of the 1mm nematode worm he studied for years. He gets around in the family car and second class on Great North Eastern Railways. Sulston is, he says, a Guardian-reading political liberal, whose wife Daphne took part in the Greenham Common anti-missile protests. He did not get to the top rungs of British science, and the forefront of a world scientific revolution, by being a laid-back guy. By chance, I had to ask him something on Easter Sunday; he was there at his desk. The Wellcome Trust may be a charity, but it is the most powerful independent scientific institution in Europe, if not the world. Its £300m purpose-built Sanger Centre is a big, big sequencing machine with one objective in mind - to clobber the opposition.
The battle between Venter and Sulston is more than a personal clash. Once the human genome is decoded, it will begin to transform medicine, science, human fertility, archaeology, genealogy, the insurance trade and the whole of human society. Knowledge of the human gemone, the code of life, will allow us to determine exactly what it is that makes us human. The code may give us the cure for cancer, heart disease, a thousand genetic human frailties. It will tell us who has a predisposition to be gay, to be depressed, to be good at metabolising oxygen and hence good at sport, to get Alzheimer's, to die of bowel cancer at 53. We are aware of some of these things already; clever parents generally have clever children; heart attacks, like some breast cancers, run in the family.
But the difference is that we will know. You can alter your behaviour, but you cannot alter your genes, yet. It will give you, and other powerful institutions in society such as insurance companies, the power to read the unique genetic bar-code that is contained in every cell of your body. Scientists have already identified 289 genes, mutations to the normal code, that directly cause diseases in humans. Soon we will know an awful lot more. We may not like the answers but we will have them.
There are a 100 trillion cells in the human body. In the nucleus of each of these cells are 46 chromosomes, 23 from your mother and 23 from your father. Those chromosomes are made of DNA, a long molecule of deoxyribonucleic acid, whose famous double helix shape was the greatest scientific discovery of the 20th century. There are six feet of DNA in each human cell. And DNA is composed of four chemicals, or bases, adenine (A), thymine (T), guanine (G) and cytosine (C).
It is these bases that are the digital code of life. Every living organism on earth, from microbes living in super-heated sulphur vents two miles down on the bottom of the ocean, to bacteria, roundworms, wheat, fish, trees, cows, chimpanzees (who share 98.9% of our human DNA) is composed of letters of the same A, T, G, C genetic code. It is the one and only alphabet of life - hence the ability of researchers to insert "fish" genes into plants.
There are 3.5 billion bases in the human genome. The human genome is, in effect, a single sentence: ccacatgatatctatccaacccatgtccccacatgatatctatccaacccatgtccccacatgata tctatccaacccatgtcc and so on until it would fill 500,000 pages of a telephone directory. It is equivalent to 750 megabytes of data and will fit on one DVD disk. Most of that genome is junk: between 95 and 97% is redundant, the left-over genetic instructions for what to do with our fins or tails; we still carry with us our evolutionary ascent from bacteria in the swamp. Scattered at random amid this genomic sentence are the 100,000 genes - active sequences - which code for the 20 amino acids that make up the body's proteins. Everything that we are as humans, from our toes to our hormones, to the synaptic gaps in our brains, muscles, bones, to when and how our cells divide, is, or is the product of, proteins. Our genes are the codes for these proteins. They are the telephone numbers that actually work.
Each of those genes can be thousands of letters long. Other parts of the genome, which do not code for genes, also act like a control mechanism and play a role in the way genes interact or the way a human foetus is formed. Our genome is the book of human life. "As long as there are humans in the universe, it will be essential," says John Sulston.
Decoding the human genome will increase our knowledge, a thousandfold times a thousandfold of the nature of Homo sapiens . And with that knowledge will come immense power. Before we create, we will almost certainly destroy, committing a new form of human selection, genomecide. Through systematic but simple foetal genetic tests in the next decade, we will ruthlessly search out and eradicate those human genes we regard as inferior, Trisonomy 21 or Down's Syndrome, Turner's Syndrome, Huntingdon's Chorea, Cystic Fibrosis; the list is as long as we want to make it. The difficulty we will have to face is where do you draw the line? Do you abort multi-celled foetuses because the tests show genes that code for Alzheimer's in later life? Would we now eradicate the former US President Ronald Reagan, whose Alzheimer's is genetically inherited, just after conception? What is the definition of an acceptable genetic human being? What is a valid human life? In America, where medical insurance is a key issue, the first cases of genetic discrimination are already appearing in the courts.
In time, we will begin to manipulate our genes, select the traits we want in our children, designer babies, just as we are now altering the genes of the plants and animals.
There will be great benefits, a cure for Aids, malaria, maybe eventually nearly all of the diseases that afflict humanity. Genomics is the future of a whole new set of pharmaceutical industries that will create thousands of individually tailored drugs.
We are at the beginning of a genomic century and in the midst of a biological gold rush. Every day, the US Patent and Trademark Office is flooded with new patent applications from US biotech companies such as Incyte, Human Genomic Sciences, and Celera, claiming patent rights - exclusive property rights - on the 100,000 genes in the human body. Celera alone is believed to have filed more than 20,000 provisional patents. Incyte aims to patent one million of what are known as ESTs, expressed sequence tags, snippets of the genetic code that identify genes, whose functions may be entirely unknown at the time of patenting.
Along with the benefits will come unparalleled profits, wealth beyond even the dreams of Microsoft's Bill Gates, as a few companies carve themselves monopolies from the code of human life. The first battles have already begun. Aids researchers have recently identified the pathway, or docking site, known as the CCR5 receptor, by which the Aids virus enters human cells. Block that doorway and, potentially, you have a cure for the most expensive disease in human history - a virus that has killed and lethally infected 30m people. But the gene for CCR5 is "owned" by Human Genomic Sciences Inc (HGS), of Rockville, Maryland, former collaborators of Venter, which is demanding royalties and licences from every drugs company that wants to work on CCR5, even though HGS admits it had no idea of the gene's function in Aids when it filed the patent application.
Having a monopoly on an individual gene is one thing, but controlling access to the human sequence itself would give the means of taxing every single biological research project for the next 20 years. Genes do not work in isolation. The 100,000 genes in every cell of our bodies interact in ways that are still unknown to us. To understand those interactions, scientists will have continually to return to the whole genome sequence. Whoever owned exclusive rights to the sequence could quite easily become the richest person in the world and stifle any research that threatened their monopoly. Controlling the sequence would be like owning copyright on the letters ABC of the alphabet. Celera's declared aim is to became the "definitive" source of genomic information, so definitive that drugs companies will pay millions for the data, even though HGP will provide a rival version for free. Being first in the race for the code would be a huge propaganda victory. But in Sulston's view, it also explains Celera's attacks on the publicly-funded project. Celera wants to undermine and degrade its only possible rival; for "definitive" read "monopoly".
For Craig Venter, the race for the code began during the 1968 Tet Offensive in a Da Nang field hospital in South Vietnam, where, as a medical corpsman, he was suddenly confronting thousands of casualties. The communist Vietcong launched a surprise offensive against US bases on the eve of the traditional Vietnamese holiday; there was bloody hand-to-hand fighting all over South Vietnam. "I had to learn, in real time, what triage actually meant. I dealt with the death of thousands of men my age. It was a life-altering experience. The biggest thing was the loss of my innocence. The loss of the sense of immortality that goes with being young. Life was so cheap in Vietnam. And that is where my sense of urgency comes from. Before that, I had no urgency at all."
Vietnam was the making of Venter. Although he came from a military family - his parents, John and Elizabeth, met in the Marines in 1943, in San Diego - he had dropped out of high school. Before he was drafted in 1965, he had been a beach bum, a champion swimmer, whose main occupation was surfing and sailing the waters of San Francisco bay. He originally intended to join the US Navy swim team, but ended up in the medical corps as a freak result of the IQ tests undertaken by every recruit. Venter had, out of 35,000 tests, the highest score, over 140, and was immediately offered a specialism. The medical corps, unlike nuclear engineering, was the only specialism that did not require signing up beyond three years. He trained as an army medic and found that he loved it.
After Vietnam, Venter returned to the US determined to get a medical degree and work in the developing world. In six years, he crash-coursed his way through a local community college to get basic qualifications, and then the University of California med school. Along the way, he shifted into medical research and began teaching at the State University of New York, where he met his future wife and collaborator, Claire Fraser.
Part of the key to Venter lies in this unorthodox academic ascent. Although the Community College of San Mateo - whose other most famous alumnus is John Belushi -and the State University of New York are competent institutions, they are far from being the great scientific centres of the West. Venter was never a traditional insider.
In the late 70s, he began working on the adrenalin receptor in the brain. Isolating genes, cloning them in sufficient quantities to engage in experiments, was a tedious, frustrating process. Sequencing was messy and cumbersome, involving radioactive dyes and X-ray film. It could take 10 years to isolate one gene. And everything depended on precious grants doled out by the scientific elite.
Now, Venter does little to mask his contempt for his scientific rivals who sat on grants committees and awarded each other the prizes. "I was not a molecular biologist, but you could not get a grant to do molecular biology unless you had trained with one of the few molecular biologists. It is part of the assumptions of science that I detest. It is part of the apprentice system that assumes you cannot go out and learn something on your own. In science, the same people, in a few powerful positions, control the input and the output. The same people get asked to review your grant - 'Should we give this guy the money' - then get asked to review the manuscript: 'No, it's trash, we don't like him.' It's more a way of controlling things than doing science."
In the 80s, Venter became a researcher at the prestigious US National Institute of Health (NIH), in Washington. He was an innovative scientist, who helped develop the technology for automated gene sequencing. Fifteen years ago, decoding just one base letter cost $10 and was a painstaking manual task. Today, both Celera and the Human Genome Project churn out millions of letters a day by using banks of sophisticated sequencers. Genomic science has become an industrial rather than a scientific process: it simply would not be possible to decode the 3.5 billion bases of the human genome without this automation. It was Venter, in 1987, who ordered the first automated gene sequencer and worked closely with the manufacturer, Applied Biosystems, to test and improve the nascent technology. It would prove to be the key relationship of Venter's scientific career. His company, Celera, is a sub-division of Perkin Elmer, the maker of the Applied Biosystems sequencers.
"The scientific community has never forgiven us for picking Craig," said one of the leading designers of sequencing technology. "They have never accepted Craig as one of their peers, never accepted that he was one of the best scientists in their midst. Sure, he is antagonistic, but Craig is prepared to take risks. Back in 1987, he bought the machine. All the others said, 'No, it's too risky, let's wait for a couple of years.' But you need someone like Craig to test and validate the system."
On a long, boring night-flight back from Tokyo, Venter also came up with a novel way - expressed sequence tags (EST) - of locating genes in the vast, bewildering genome. DNA is transcribed into protein via a slightly different compound Messenger RNA. By cloning this mRNA back into what is known as complementary DNA (cDNA), Venter short-circuited the laborious hunt for genes. ESTs are a clever, but patchy, way of using a cell's own mechanism to help find genes. ESTs, gene fragments, are like marker flags that identify individual genes and locate their position in the genome.
With his EST strategy and primitive but state-of-the-art gene sequencer, Venter was soon cranking out more human code, and locating more genes, in a day than other scientists had done over decades. But it was Venter's next move that shocked the scientific community. In 1990, the Human Genome Project, the international effort to decode the human genome, was finally launched after years of carefully-crafted international agreements with Britain, France and Japan. It was the biological equivalent of sending a man to the moon, with a budget of $3billion, and was expected to take until 2010 to complete.
In June 1991, in the US, the National Institute of Health (NIH), where Venter was still working, without warning filed 6,500 patents on Venter's ESTs. It seemed to be the opening salvo in a nationalistic biotech war. The harshest criticism came from the NIH bureaucracy itself, where James Watson, the Nobel Prize-winning co-discoverer of DNA and leader of the Genome Project, denounced Venter's patents as "monkey work". There was a damaging row. Venter's attempts to get more grant funding, despite his successful sequencing track record, were mysteriously rejected and the patent applications overturned. Stung by the personal criticism, Venter left NIH, and public science, in June 1992 to found a private research institute, The Institute for Genomic Research (TIGR). Although TIGR was run as a charity, it was funded by the aggressive patent-seeking biotech firm Human Genomics Sciences that had ownership rights over TIGR's discoveries. The real race for the code was just beginning.
Read part two